Transcript: Human XM_017024323.2

PREDICTED: Homo sapiens sterile alpha motif domain containing 14 (SAMD14), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAMD14 (201191)
Length:
3383
CDS:
546..1799

Additional Resources:

NCBI RefSeq record:
XM_017024323.2
NBCI Gene record:
SAMD14 (201191)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424452 ACCATCGGCCTCGATAAGAAG pLKO_005 1086 CDS 100% 4.950 6.930 N SAMD14 n/a
2 TRCN0000105796 AGAAGTCAGCTTCCCAGGAAT pLKO.1 1351 CDS 100% 4.950 6.930 N Samd14 n/a
3 TRCN0000180627 GCAGGAGGCCAAATGTTCTTA pLKO.1 1433 CDS 100% 5.625 4.500 N SAMD14 n/a
4 TRCN0000180458 GCTGGACGGAAGCAAACTAAA pLKO.1 1622 CDS 100% 13.200 9.240 N SAMD14 n/a
5 TRCN0000149122 GAACAGTATGCTGCTGAGTTT pLKO.1 1566 CDS 100% 4.950 3.465 N SAMD14 n/a
6 TRCN0000179692 GTCTCAGTCTTCAGATGAGTT pLKO.1 1469 CDS 100% 4.950 3.465 N SAMD14 n/a
7 TRCN0000431123 CAGCCCTAAGAAGTCAGCTTC pLKO_005 1343 CDS 100% 4.050 2.835 N SAMD14 n/a
8 TRCN0000180936 GAAGCGCAAGTTGAAGGAGAT pLKO.1 1682 CDS 100% 4.050 2.835 N SAMD14 n/a
9 TRCN0000430217 TGGTGAAGCGCAAGTTGAAGG pLKO_005 1678 CDS 100% 4.050 2.835 N SAMD14 n/a
10 TRCN0000180079 CGGAAGCAAACTAAAGAGCCT pLKO.1 1628 CDS 100% 0.660 0.462 N SAMD14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024323.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.