Transcript: Human XM_017024383.1

PREDICTED: Homo sapiens zinc finger ZZ-type and EF-hand domain containing 1 (ZZEF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZZEF1 (23140)
Length:
10836
CDS:
126..9023

Additional Resources:

NCBI RefSeq record:
XM_017024383.1
NBCI Gene record:
ZZEF1 (23140)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296243 TTCACACTGGATTCGTTTAAA pLKO_005 977 CDS 100% 15.000 21.000 N ZZEF1 n/a
2 TRCN0000055665 CGCTGCGTTTATATGGATAAT pLKO.1 6903 CDS 100% 13.200 18.480 N ZZEF1 n/a
3 TRCN0000055667 CCCGTATAACAACAACACCAA pLKO.1 8243 CDS 100% 2.640 3.696 N ZZEF1 n/a
4 TRCN0000296242 AGACTGGCCATCAACGATTAA pLKO_005 8638 CDS 100% 13.200 10.560 N ZZEF1 n/a
5 TRCN0000296244 CCGTTCACTGTGCACGTATTT pLKO_005 2816 CDS 100% 13.200 9.240 N ZZEF1 n/a
6 TRCN0000296245 GATCTTGCCGTGGACCTTATT pLKO_005 3087 CDS 100% 13.200 9.240 N ZZEF1 n/a
7 TRCN0000055666 GCCAAGATGAACATCAGTGAA pLKO.1 2889 CDS 100% 4.950 3.465 N ZZEF1 n/a
8 TRCN0000055664 GCCTTGATATTCACTCGTCAA pLKO.1 658 CDS 100% 4.050 2.835 N ZZEF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024383.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.