Transcript: Human XM_017024404.2

PREDICTED: Homo sapiens ATP binding cassette subfamily A member 6 (ABCA6), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCA6 (23460)
Length:
5188
CDS:
229..5082

Additional Resources:

NCBI RefSeq record:
XM_017024404.2
NBCI Gene record:
ABCA6 (23460)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427124 ACAAGAGGTACAACGAATATT pLKO_005 2004 CDS 100% 15.000 21.000 N ABCA6 n/a
2 TRCN0000415547 GGTATTTGGAATCGCAATATT pLKO_005 2808 CDS 100% 15.000 21.000 N ABCA6 n/a
3 TRCN0000060259 GCTCCGTTTCTTAAAGTTAAA pLKO.1 2754 CDS 100% 13.200 9.240 N ABCA6 n/a
4 TRCN0000412480 GGACTAATGCTAAGGTTATTG pLKO_005 1562 CDS 100% 13.200 9.240 N ABCA6 n/a
5 TRCN0000060262 GCTATCATAGTTTCTGGTAAA pLKO.1 3076 CDS 100% 10.800 7.560 N ABCA6 n/a
6 TRCN0000060258 GCAGAAATTAACAGCAGGAAT pLKO.1 4458 CDS 100% 4.950 3.465 N ABCA6 n/a
7 TRCN0000060261 CCCTACTTTCAGACTTTGCTA pLKO.1 3835 CDS 100% 3.000 2.100 N ABCA6 n/a
8 TRCN0000060260 GCGCCATTATTCTCCTTTATT pLKO.1 1506 CDS 100% 15.000 9.000 N ABCA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024404.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.