Transcript: Human XM_017024458.2

PREDICTED: Homo sapiens fatty acid desaturase 6 (FADS6), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FADS6 (283985)
Length:
1309
CDS:
46..1140

Additional Resources:

NCBI RefSeq record:
XM_017024458.2
NBCI Gene record:
FADS6 (283985)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422540 CTGATTTCTCTGGGCCTTTAT pLKO_005 631 CDS 100% 13.200 9.240 N FADS6 n/a
2 TRCN0000064779 CCACTACACACTCACTGTCAA pLKO.1 303 CDS 100% 4.950 3.465 N FADS6 n/a
3 TRCN0000064781 GCTGCATGTTCCTCACCAGAT pLKO.1 710 CDS 100% 4.050 2.835 N FADS6 n/a
4 TRCN0000064780 CCGTCGCTATGAGGAATTCAT pLKO.1 1038 CDS 100% 0.000 0.000 N FADS6 n/a
5 TRCN0000064778 GCCATGTGGAACACCATCTAT pLKO.1 899 CDS 100% 5.625 3.375 N FADS6 n/a
6 TRCN0000064782 CCTGGTCTTTGCATCCGGCAT pLKO.1 264 CDS 100% 0.720 0.432 N FADS6 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1252 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024458.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.