Transcript: Human XM_017024619.1

PREDICTED: Homo sapiens leucine rich repeat containing 75A (LRRC75A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC75A (388341)
Length:
2578
CDS:
16..1005

Additional Resources:

NCBI RefSeq record:
XM_017024619.1
NBCI Gene record:
LRRC75A (388341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140125 GCCCATGCATACAGGCATAAA pLKO.1 1683 3UTR 100% 13.200 18.480 N LRRC75A n/a
2 TRCN0000142448 GCTGGAACAAAGCTACACCAA pLKO.1 2347 3UTR 100% 2.640 2.112 N LRRC75A n/a
3 TRCN0000144723 GCCTTAAATGCTTTGAGCTTT pLKO.1 2407 3UTR 100% 4.950 3.465 N LRRC75A n/a
4 TRCN0000168114 CCTATCCCATTATCTGCCATT pLKO.1 1206 3UTR 100% 4.050 2.835 N LRRC75A n/a
5 TRCN0000143005 CCCATTATCTGCCATTTGGTT pLKO.1 1211 3UTR 100% 3.000 1.800 N LRRC75A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024619.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.