Transcript: Human XM_017024715.2

PREDICTED: Homo sapiens myosin XVA (MYO15A), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MYO15A (51168)
Length:
12668
CDS:
699..11294

Additional Resources:

NCBI RefSeq record:
XM_017024715.2
NBCI Gene record:
MYO15A (51168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428131 TCCAACCTCAAGATTAGATTT pLKO_005 4416 CDS 100% 13.200 18.480 N MYO15A n/a
2 TRCN0000083326 CCCTACACAATGCTCGAGTTT pLKO.1 9726 CDS 100% 0.000 0.000 N MYO15A n/a
3 TRCN0000083324 GCTGTGTATTAACTACGCAAA pLKO.1 5507 CDS 100% 4.050 3.240 N MYO15A n/a
4 TRCN0000432828 AGAACCAGTGCATAATCATTA pLKO_005 4618 CDS 100% 13.200 9.240 N MYO15A n/a
5 TRCN0000427319 AGATGTGGTAATGGCACAATT pLKO_005 6128 CDS 100% 13.200 9.240 N MYO15A n/a
6 TRCN0000083325 CCCTACGATGTACCCTACTTT pLKO.1 1785 CDS 100% 5.625 3.938 N MYO15A n/a
7 TRCN0000083323 CTTTGGTTATTTCTGTGCAAA pLKO.1 11777 3UTR 100% 4.950 3.465 N MYO15A n/a
8 TRCN0000083327 CCCACACAGCAGATCAAGAAT pLKO.1 8415 CDS 100% 5.625 3.375 N MYO15A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.