Transcript: Human XM_017024764.2

PREDICTED: Homo sapiens phospholipase D2 (PLD2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLD2 (5338)
Length:
3450
CDS:
1269..2882

Additional Resources:

NCBI RefSeq record:
XM_017024764.2
NBCI Gene record:
PLD2 (5338)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236521 ACAGCATGGCGGGACTATATT pLKO_005 2292 CDS 100% 15.000 21.000 N PLD2 n/a
2 TRCN0000236520 GGACCGGCCTTTCGAAGATTT pLKO_005 1679 CDS 100% 13.200 18.480 N PLD2 n/a
3 TRCN0000236519 TCAATCCTGCATCGCCTTAAA pLKO_005 2259 CDS 100% 13.200 18.480 N PLD2 n/a
4 TRCN0000051150 CCGAAAGATATACCAGCGGAT pLKO.1 277 5UTR 100% 2.160 3.024 N PLD2 n/a
5 TRCN0000051151 CCTCTCTCACAACCAATTCTT pLKO.1 1607 CDS 100% 5.625 4.500 N PLD2 n/a
6 TRCN0000236522 CAAGGACTACAGCAATCTTAT pLKO_005 1637 CDS 100% 13.200 9.240 N PLD2 n/a
7 TRCN0000051148 CCAAGAAGAAATACCGTCATT pLKO.1 361 5UTR 100% 4.950 3.465 N PLD2 n/a
8 TRCN0000051152 CGATGAGATTGTGGACAGAAT pLKO.1 2087 CDS 100% 4.950 3.465 N PLD2 n/a
9 TRCN0000236523 GCAGGGTCAAGCCTCTTATTC pLKO_005 3174 3UTR 100% 13.200 7.920 N PLD2 n/a
10 TRCN0000051149 GCCAAGTACAAGACTCCCATA pLKO.1 1824 CDS 100% 4.050 2.835 N PLD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024764.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.