Transcript: Human XM_017024949.1

PREDICTED: Homo sapiens nucleoredoxin (NXN), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NXN (64359)
Length:
2709
CDS:
89..1054

Additional Resources:

NCBI RefSeq record:
XM_017024949.1
NBCI Gene record:
NXN (64359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017024949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064239 GCTCAAACTTTGGAACAAATA pLKO.1 448 CDS 100% 13.200 18.480 N NXN n/a
2 TRCN0000299746 GCTCAAACTTTGGAACAAATA pLKO_005 448 CDS 100% 13.200 18.480 N NXN n/a
3 TRCN0000064238 GCGTCTATTTCTCCGCACATT pLKO.1 678 CDS 100% 4.950 6.930 N NXN n/a
4 TRCN0000299815 GCGTCTATTTCTCCGCACATT pLKO_005 678 CDS 100% 4.950 6.930 N NXN n/a
5 TRCN0000064240 CCAACATTCCATCACTAATAT pLKO.1 477 CDS 100% 15.000 10.500 N NXN n/a
6 TRCN0000064242 CCTGGTGGAATCCTACCGGAA pLKO.1 730 CDS 100% 0.720 0.504 N NXN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017024949.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.