Transcript: Human XM_017025171.1

PREDICTED: Homo sapiens SRC kinase signaling inhibitor 1 (SRCIN1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRCIN1 (80725)
Length:
7226
CDS:
189..3944

Additional Resources:

NCBI RefSeq record:
XM_017025171.1
NBCI Gene record:
SRCIN1 (80725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025171.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162192 CAGAACCTCTATCCCTGTATT pLKO.1 3884 CDS 100% 13.200 18.480 N SRCIN1 n/a
2 TRCN0000163534 GCAGGCCACTAAACCATCTAA pLKO.1 3806 CDS 100% 5.625 7.875 N SRCIN1 n/a
3 TRCN0000163238 GCAGCCAAACTACTGGAGTTT pLKO.1 713 CDS 100% 0.495 0.396 N SRCIN1 n/a
4 TRCN0000163913 CCAGAACCTCTATCCCTGTAT pLKO.1 3883 CDS 100% 4.950 3.465 N SRCIN1 n/a
5 TRCN0000159279 GCAGTATTATCAAGATCTACA pLKO.1 1147 CDS 100% 4.950 3.465 N SRCIN1 n/a
6 TRCN0000164281 CTTCAACAAGAGCGTGGACTT pLKO.1 2951 CDS 100% 4.050 2.835 N SRCIN1 n/a
7 TRCN0000163712 GACTGACTTCAACAAGAGCGT pLKO.1 2945 CDS 100% 0.660 0.462 N SRCIN1 n/a
8 TRCN0000163288 GTGGACAAAGCTGTGTCTGTT pLKO.1 3096 CDS 100% 4.950 2.970 N SRCIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025171.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.