Transcript: Human XM_017025173.1

PREDICTED: Homo sapiens SRC kinase signaling inhibitor 1 (SRCIN1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRCIN1 (80725)
Length:
5670
CDS:
189..3815

Additional Resources:

NCBI RefSeq record:
XM_017025173.1
NBCI Gene record:
SRCIN1 (80725)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000163238 GCAGCCAAACTACTGGAGTTT pLKO.1 713 CDS 100% 0.495 0.396 N SRCIN1 n/a
2 TRCN0000159279 GCAGTATTATCAAGATCTACA pLKO.1 1147 CDS 100% 4.950 3.465 N SRCIN1 n/a
3 TRCN0000164281 CTTCAACAAGAGCGTGGACTT pLKO.1 2951 CDS 100% 4.050 2.835 N SRCIN1 n/a
4 TRCN0000163712 GACTGACTTCAACAAGAGCGT pLKO.1 2945 CDS 100% 0.660 0.462 N SRCIN1 n/a
5 TRCN0000163288 GTGGACAAAGCTGTGTCTGTT pLKO.1 3096 CDS 100% 4.950 2.970 N SRCIN1 n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5233 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5233 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025173.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.