Transcript: Human XM_017025317.1

PREDICTED: Homo sapiens sperm antigen with calponin homology and coiled-coil domains 1 (SPECC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPECC1 (92521)
Length:
3610
CDS:
4..3222

Additional Resources:

NCBI RefSeq record:
XM_017025317.1
NBCI Gene record:
SPECC1 (92521)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426934 TAGAACTGGAACGGCATAATA pLKO_005 1571 CDS 100% 15.000 21.000 N SPECC1 n/a
2 TRCN0000429972 GTGACACGGAACCTATGATAA pLKO_005 662 CDS 100% 13.200 18.480 N SPECC1 n/a
3 TRCN0000418623 TCCGGCATGAAGAGTTCTAAG pLKO_005 91 CDS 100% 10.800 15.120 N SPECC1 n/a
4 TRCN0000180714 GCCCAAATGTCGATGGAACAT pLKO.1 629 CDS 100% 4.950 3.960 N SPECC1 n/a
5 TRCN0000432968 ATTATCAGACCAGCAACAAAT pLKO_005 1194 CDS 100% 13.200 9.240 N SPECC1 n/a
6 TRCN0000183786 CCAGTGACATTGATGAGTATA pLKO.1 884 CDS 100% 13.200 9.240 N SPECC1 n/a
7 TRCN0000436269 GAGCTGCGAAGTTCAAGAAAT pLKO_005 1731 CDS 100% 13.200 9.240 N SPECC1 n/a
8 TRCN0000431720 TGGATCTTTGAAGTCTCATTT pLKO_005 1656 CDS 100% 13.200 9.240 N SPECC1 n/a
9 TRCN0000183133 CCAAGGAGCTTTAGAAATGAT pLKO.1 1509 CDS 100% 5.625 3.938 N SPECC1 n/a
10 TRCN0000183426 CCTTTAAGAGTTCAAAGTGTT pLKO.1 1049 CDS 100% 4.950 3.465 N SPECC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.