Transcript: Human XM_017025530.1

PREDICTED: Homo sapiens oxysterol binding protein like 1A (OSBPL1A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL1A (114876)
Length:
4496
CDS:
456..3362

Additional Resources:

NCBI RefSeq record:
XM_017025530.1
NBCI Gene record:
OSBPL1A (114876)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322578 AGATCACGATGCCAGTTATAT pLKO_005 2197 CDS 100% 15.000 21.000 N OSBPL1A n/a
2 TRCN0000322579 AGCGTTCTTCTATGGCGAATA pLKO_005 2997 CDS 100% 10.800 15.120 N OSBPL1A n/a
3 TRCN0000151347 GCAAAGTACCTGTGTACTTAA pLKO.1 4251 3UTR 100% 1.320 1.848 N OSBPL1A n/a
4 TRCN0000153418 GCCGGATTCTGAAAGTGTATT pLKO.1 2963 CDS 100% 13.200 10.560 N OSBPL1A n/a
5 TRCN0000322647 ATTTCATGCTGAAGGATTAAA pLKO_005 2480 CDS 100% 15.000 10.500 N OSBPL1A n/a
6 TRCN0000150945 GATCACGATGCCAGTTATATT pLKO.1 2198 CDS 100% 15.000 10.500 N OSBPL1A n/a
7 TRCN0000322649 GATGTAACCTTTGACATATTT pLKO_005 3761 3UTR 100% 15.000 10.500 N OSBPL1A n/a
8 TRCN0000151346 GAGGCATATACATGGACAAAT pLKO.1 2610 CDS 100% 13.200 9.240 N OSBPL1A n/a
9 TRCN0000322648 TGAACACAATGAGGCATATAC pLKO_005 2600 CDS 100% 13.200 9.240 N OSBPL1A n/a
10 TRCN0000155413 CTGCTGGGAGAGACTTATGAA pLKO.1 2391 CDS 100% 5.625 3.938 N OSBPL1A n/a
11 TRCN0000151670 GCATCAAGAAACACAGAACAA pLKO.1 2095 CDS 100% 4.950 2.970 N OSBPL1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025530.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.