Transcript: Human XM_017025533.2

PREDICTED: Homo sapiens oxysterol binding protein like 1A (OSBPL1A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OSBPL1A (114876)
Length:
2794
CDS:
353..1666

Additional Resources:

NCBI RefSeq record:
XM_017025533.2
NBCI Gene record:
OSBPL1A (114876)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000322578 AGATCACGATGCCAGTTATAT pLKO_005 501 CDS 100% 15.000 21.000 N OSBPL1A n/a
2 TRCN0000322579 AGCGTTCTTCTATGGCGAATA pLKO_005 1301 CDS 100% 10.800 15.120 N OSBPL1A n/a
3 TRCN0000151347 GCAAAGTACCTGTGTACTTAA pLKO.1 2555 3UTR 100% 1.320 1.848 N OSBPL1A n/a
4 TRCN0000153418 GCCGGATTCTGAAAGTGTATT pLKO.1 1267 CDS 100% 13.200 10.560 N OSBPL1A n/a
5 TRCN0000322647 ATTTCATGCTGAAGGATTAAA pLKO_005 784 CDS 100% 15.000 10.500 N OSBPL1A n/a
6 TRCN0000150945 GATCACGATGCCAGTTATATT pLKO.1 502 CDS 100% 15.000 10.500 N OSBPL1A n/a
7 TRCN0000322649 GATGTAACCTTTGACATATTT pLKO_005 2065 3UTR 100% 15.000 10.500 N OSBPL1A n/a
8 TRCN0000151346 GAGGCATATACATGGACAAAT pLKO.1 914 CDS 100% 13.200 9.240 N OSBPL1A n/a
9 TRCN0000322648 TGAACACAATGAGGCATATAC pLKO_005 904 CDS 100% 13.200 9.240 N OSBPL1A n/a
10 TRCN0000155413 CTGCTGGGAGAGACTTATGAA pLKO.1 695 CDS 100% 5.625 3.938 N OSBPL1A n/a
11 TRCN0000151670 GCATCAAGAAACACAGAACAA pLKO.1 399 CDS 100% 4.950 2.970 N OSBPL1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.