Transcript: Human XM_017025667.2

PREDICTED: Homo sapiens ankyrin repeat domain 12 (ANKRD12), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKRD12 (23253)
Length:
8213
CDS:
1163..6472

Additional Resources:

NCBI RefSeq record:
XM_017025667.2
NBCI Gene record:
ANKRD12 (23253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025667.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425266 AGCAATCAAGGTAGCTTATTA pLKO_005 4271 CDS 100% 15.000 21.000 N ANKRD12 n/a
2 TRCN0000417992 GACTTGCCGGAGCGGATTAAA pLKO_005 4085 CDS 100% 15.000 21.000 N ANKRD12 n/a
3 TRCN0000127737 GCTAATCAAGAGCCAGGTATT pLKO.1 4826 CDS 100% 10.800 15.120 N ANKRD12 n/a
4 TRCN0000129083 GCAAGAACATTGGCAAATCAA pLKO.1 6101 CDS 100% 5.625 4.500 N ANKRD12 n/a
5 TRCN0000130913 GCTGCTGAACTTGTTAGACAT pLKO.1 7886 3UTR 100% 4.950 3.960 N ANKRD12 n/a
6 TRCN0000421513 AGTGCCATTGAGGAATCTATA pLKO_005 2654 CDS 100% 13.200 9.240 N ANKRD12 n/a
7 TRCN0000419004 GAAGATCATAGTCCAACATTT pLKO_005 2162 CDS 100% 13.200 9.240 N ANKRD12 n/a
8 TRCN0000128899 GCAAGTATGTTTCAGCTGATA pLKO.1 4419 CDS 100% 4.950 3.465 N ANKRD12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025667.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.