Transcript: Human XM_017025743.1

PREDICTED: Homo sapiens laminin subunit alpha 3 (LAMA3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LAMA3 (3909)
Length:
8372
CDS:
74..7954

Additional Resources:

NCBI RefSeq record:
XM_017025743.1
NBCI Gene record:
LAMA3 (3909)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335907 AGGTTTAATAGCGAATCTAAT pLKO_005 8062 3UTR 100% 13.200 18.480 N LAMA3 n/a
2 TRCN0000005438 CAGGTTTAATAGCGAATCTAA pLKO.1 8061 3UTR 100% 5.625 7.875 N LAMA3 n/a
3 TRCN0000005442 CCGGGATTCTTTAAATGAATA pLKO.1 4024 CDS 100% 13.200 9.240 N LAMA3 n/a
4 TRCN0000335821 CCGGGATTCTTTAAATGAATA pLKO_005 4024 CDS 100% 13.200 9.240 N LAMA3 n/a
5 TRCN0000005441 CGGGCACTAAGAACTCCTTTA pLKO.1 7035 CDS 100% 10.800 7.560 N LAMA3 n/a
6 TRCN0000335823 CGGGCACTAAGAACTCCTTTA pLKO_005 7035 CDS 100% 10.800 7.560 N LAMA3 n/a
7 TRCN0000005440 CGGGATCATAAAGGCTTGTAT pLKO.1 2972 CDS 100% 5.625 3.938 N LAMA3 n/a
8 TRCN0000335904 CGGGATCATAAAGGCTTGTAT pLKO_005 2972 CDS 100% 5.625 3.938 N LAMA3 n/a
9 TRCN0000005439 CCCTCCATACAAAGGTTGTAT pLKO.1 5617 CDS 100% 0.563 0.394 N LAMA3 n/a
10 TRCN0000335822 CCCTCCATACAAAGGTTGTAT pLKO_005 5617 CDS 100% 0.563 0.394 N LAMA3 n/a
11 TRCN0000110333 CTCAAGAGAGATGTGTCCCTA pLKO.1 6704 CDS 100% 2.640 1.848 N Ugt1a6b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.