Transcript: Human XM_017025806.1

PREDICTED: Homo sapiens centrosomal protein 192 (CEP192), transcript variant X14, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP192 (55125)
Length:
7465
CDS:
1471..7182

Additional Resources:

NCBI RefSeq record:
XM_017025806.1
NBCI Gene record:
CEP192 (55125)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134645 GAGAGAACCTATTGCCTTAAT pLKO.1 1410 5UTR 100% 13.200 18.480 N CEP192 n/a
2 TRCN0000135907 GCGAGTTGAGTACCACAATTA pLKO.1 2768 CDS 100% 13.200 9.240 N CEP192 n/a
3 TRCN0000135060 CCCAAAGAACAAACTACTCAA pLKO.1 2005 CDS 100% 4.950 3.465 N CEP192 n/a
4 TRCN0000134623 GAGGCATCAGTTAATACTGAT pLKO.1 1735 CDS 100% 0.495 0.347 N CEP192 n/a
5 TRCN0000135014 CCTGTTACATAAACCAGAGAT pLKO.1 5562 CDS 100% 4.950 2.970 N CEP192 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.