Transcript: Human XM_017025993.1

PREDICTED: Homo sapiens GREB1 like retinoic acid receptor coactivator (GREB1L), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GREB1L (80000)
Length:
7378
CDS:
179..6046

Additional Resources:

NCBI RefSeq record:
XM_017025993.1
NBCI Gene record:
GREB1L (80000)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017025993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429992 TCACTTTGTGGCGCGATTAAA pLKO_005 3187 CDS 100% 15.000 21.000 N GREB1L n/a
2 TRCN0000005375 GCTCTCCACAACTCCATAGAA pLKO.1 227 CDS 100% 5.625 7.875 N GREB1L n/a
3 TRCN0000005372 CCCTATTTCTATGGAAATGTT pLKO.1 1400 CDS 100% 0.563 0.450 N GREB1L n/a
4 TRCN0000005371 CGGTTAATTGACTCAAGCTAT pLKO.1 3347 CDS 100% 4.950 3.465 N GREB1L n/a
5 TRCN0000005373 GCGTTTGGTATCACTGTGTAT pLKO.1 559 CDS 100% 4.950 3.465 N GREB1L n/a
6 TRCN0000005374 GCTGCTATGATTCCCACACAA pLKO.1 2135 CDS 100% 4.950 3.465 N GREB1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017025993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.