Transcript: Human XM_017026010.1

PREDICTED: Homo sapiens formin homology 2 domain containing 3 (FHOD3), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FHOD3 (80206)
Length:
5221
CDS:
1..4695

Additional Resources:

NCBI RefSeq record:
XM_017026010.1
NBCI Gene record:
FHOD3 (80206)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138289 CCACCTTATGCAATTCGGGAA pLKO.1 4090 CDS 100% 2.160 3.024 N FHOD3 n/a
2 TRCN0000138615 CCTCACCAACAAACGGTTCAT pLKO.1 2415 CDS 100% 4.950 3.960 N FHOD3 n/a
3 TRCN0000258088 AGACTGTGCAGAGCGAATTAT pLKO_005 4002 CDS 100% 15.000 10.500 N Fhod3 n/a
4 TRCN0000216355 GATCAACTTCAGGATAATTTA pLKO.1 3877 CDS 100% 15.000 10.500 N Fhod3 n/a
5 TRCN0000250590 GATCAACTTCAGGATAATTTA pLKO_005 3877 CDS 100% 15.000 10.500 N Fhod3 n/a
6 TRCN0000134338 GTGGAGCAACTCAACATTTAT pLKO.1 700 CDS 100% 15.000 10.500 N FHOD3 n/a
7 TRCN0000138944 GCCGAAGACAGAGTCTGATTA pLKO.1 2739 CDS 100% 13.200 9.240 N FHOD3 n/a
8 TRCN0000133772 CACCCGGTTTATTAGTTCAAA pLKO.1 4934 3UTR 100% 5.625 3.938 N FHOD3 n/a
9 TRCN0000137942 GCAAGCTCTTGCTGGATGAAA pLKO.1 4734 3UTR 100% 5.625 3.938 N FHOD3 n/a
10 TRCN0000137037 CAAACGGTTCATGCTTGACAT pLKO.1 2424 CDS 100% 4.950 3.465 N FHOD3 n/a
11 TRCN0000134103 CAAATCACTTCTGTCACAGTT pLKO.1 4998 3UTR 100% 4.950 3.465 N FHOD3 n/a
12 TRCN0000134611 GAAACAAATTCAGCCGAGATT pLKO.1 1784 CDS 100% 4.950 3.465 N FHOD3 n/a
13 TRCN0000137361 GCCAAGGTTGACTTTGATCAA pLKO.1 3862 CDS 100% 4.950 3.465 N FHOD3 n/a
14 TRCN0000134152 CCTGTTTGAGTCTAAATCCAA pLKO.1 3204 CDS 100% 3.000 2.100 N FHOD3 n/a
15 TRCN0000136703 GCAAATCACTTCTGTCACAGT pLKO.1 4997 3UTR 100% 2.640 1.848 N FHOD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026010.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.