Transcript: Human XM_017026080.1

PREDICTED: Homo sapiens DLG associated protein 1 (DLGAP1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DLGAP1 (9229)
Length:
5613
CDS:
295..2460

Additional Resources:

NCBI RefSeq record:
XM_017026080.1
NBCI Gene record:
DLGAP1 (9229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047148 CCGTTTGCCCATCTCCTTCTT pLKO.1 2648 3UTR 100% 4.950 6.930 N DLGAP1 n/a
2 TRCN0000047150 GCCCGAAGACATTCTAGGAAA pLKO.1 1995 CDS 100% 4.950 6.930 N DLGAP1 n/a
3 TRCN0000441378 GGGCCAGCGAGGAGATATTAT pLKO_005 1248 CDS 100% 15.000 10.500 N DLGAP1 n/a
4 TRCN0000432250 AGAATGCGGAGTGGCAGTTAT pLKO_005 547 CDS 100% 13.200 9.240 N DLGAP1 n/a
5 TRCN0000088936 CGACCTGGACTTCCATGATAA pLKO.1 1632 CDS 100% 13.200 9.240 N Dlgap1 n/a
6 TRCN0000047149 CGAGGTAAAGATGATGAAATT pLKO.1 517 CDS 100% 13.200 9.240 N DLGAP1 n/a
7 TRCN0000425412 TGATGACTTTGACACGGATTT pLKO_005 1788 CDS 100% 10.800 7.560 N DLGAP1 n/a
8 TRCN0000047151 CGGTGTCATCTTGCATTACAA pLKO.1 1115 CDS 100% 5.625 3.938 N DLGAP1 n/a
9 TRCN0000047152 GCGGAGAGAAAGCTATCTCAA pLKO.1 639 CDS 100% 4.950 3.465 N DLGAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026080.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.