Transcript: Human XM_017026100.1

PREDICTED: Homo sapiens cap binding complex dependent translation initiation factor (CTIF), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTIF (9811)
Length:
5847
CDS:
339..2189

Additional Resources:

NCBI RefSeq record:
XM_017026100.1
NBCI Gene record:
CTIF (9811)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136828 CGACAAGATGGCGCTCTTTAT pLKO.1 1697 CDS 100% 13.200 18.480 N CTIF n/a
2 TRCN0000136359 CAAAGACAACTCTCTGGACAT pLKO.1 647 CDS 100% 4.050 5.670 N CTIF n/a
3 TRCN0000136829 CCAACACCTTCGATTCCTTCA pLKO.1 691 CDS 100% 4.050 5.670 N CTIF n/a
4 TRCN0000137410 GCCGCTTCCTTATTTGCTCTT pLKO.1 3636 3UTR 100% 4.050 5.670 N CTIF n/a
5 TRCN0000136289 GCAGTACTACAACAGAACCAT pLKO.1 2150 CDS 100% 3.000 4.200 N CTIF n/a
6 TRCN0000137009 CAAGCTGATCGAGATCCTGAA pLKO.1 1511 CDS 100% 4.050 2.835 N CTIF n/a
7 TRCN0000135665 GAACAAGATGGACAAGCTGAT pLKO.1 1499 CDS 100% 4.050 2.835 N CTIF n/a
8 TRCN0000135172 CAATCTCAGGATGTGAAGGAA pLKO.1 1926 CDS 100% 3.000 2.100 N CTIF n/a
9 TRCN0000137190 GTGAAGGAAGATGCTGTCCTT pLKO.1 1938 CDS 100% 0.264 0.185 N CTIF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026100.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.