Transcript: Human XM_017026243.2

PREDICTED: Homo sapiens glutamate ionotropic receptor NMDA type subunit 3B (GRIN3B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRIN3B (116444)
Length:
2617
CDS:
844..2592

Additional Resources:

NCBI RefSeq record:
XM_017026243.2
NBCI Gene record:
GRIN3B (116444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220060 TCACCAGCTTCAGTATCAACT pLKO.1 851 CDS 100% 4.950 3.960 N GRIN3B n/a
2 TRCN0000220061 CCACGACAAGTGGTACAAGAT pLKO.1 1674 CDS 100% 4.950 3.465 N GRIN3B n/a
3 TRCN0000421013 GAGTTCATCAGCCGCTACAAG pLKO_005 1630 CDS 100% 4.950 3.465 N GRIN3B n/a
4 TRCN0000419789 TGTGCTACGCCATCCTCTTCA pLKO_005 1130 CDS 100% 4.950 3.465 N GRIN3B n/a
5 TRCN0000180859 GCAGATGAGCATCTACCACTT pLKO.1 1737 CDS 100% 4.050 2.835 N GRIN3B n/a
6 TRCN0000421865 ACCGTCTTCTCCTACTCCTCA pLKO_005 1099 CDS 100% 2.640 1.848 N GRIN3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026243.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.