Transcript: Human XM_017026450.1

PREDICTED: Homo sapiens ephrin A2 (EFNA2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFNA2 (1943)
Length:
2832
CDS:
738..1346

Additional Resources:

NCBI RefSeq record:
XM_017026450.1
NBCI Gene record:
EFNA2 (1943)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026450.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421387 ACCAGCAATAACTCGTGTAGC pLKO_005 1260 CDS 100% 4.050 5.670 N EFNA2 n/a
2 TRCN0000058254 GACATCTACTGCCCGCACTAT pLKO.1 912 CDS 100% 4.950 3.465 N EFNA2 n/a
3 TRCN0000058253 GCTCAAGTTCTCGGAGAAGTT pLKO.1 1073 CDS 100% 4.950 3.465 N EFNA2 n/a
4 TRCN0000058256 CATGGAGCACTACGTGCTGTA pLKO.1 959 CDS 100% 4.050 2.835 N EFNA2 n/a
5 TRCN0000058255 CGGCCACGAGTATTACTACAT pLKO.1 1136 CDS 100% 4.950 2.970 N EFNA2 n/a
6 TRCN0000418465 TACACGGTGGAGGTGAGCATC pLKO_005 879 CDS 100% 1.350 0.810 N EFNA2 n/a
7 TRCN0000138391 CGCCTGTAATCCTAGCACTTT pLKO.1 383 5UTR 100% 4.950 2.475 Y DENND6A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026450.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.