Transcript: Human XM_017026773.2

PREDICTED: Homo sapiens zinc finger protein 568 (ZNF568), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF568 (374900)
Length:
4492
CDS:
783..2525

Additional Resources:

NCBI RefSeq record:
XM_017026773.2
NBCI Gene record:
ZNF568 (374900)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021120 GTCATCTGTTACGCTACATAT pLKO.1 1712 CDS 100% 13.200 10.560 N ZNF568 n/a
2 TRCN0000021121 GATAAGGGTTTGGAACATAAT pLKO.1 1134 CDS 100% 13.200 9.240 N ZNF568 n/a
3 TRCN0000021123 GCTTTCTCTCAATGCTCAGTA pLKO.1 1782 CDS 100% 4.950 3.465 N ZNF568 n/a
4 TRCN0000021122 CAGTCATAAATTTGACCTCAT pLKO.1 1283 CDS 100% 4.050 2.835 N ZNF568 n/a
5 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1996 CDS 100% 5.625 2.813 Y ZNF345 n/a
6 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1587 CDS 100% 4.950 2.475 Y ZNF829 n/a
7 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1593 CDS 100% 4.050 2.025 Y ZNF700 n/a
8 TRCN0000012945 GCAGTGAATGTGGGAAAGCTT pLKO.1 2017 CDS 100% 3.000 1.500 Y ZNF146 n/a
9 TRCN0000016211 GCGAATTCACACTGGAGAGAA pLKO.1 1565 CDS 100% 0.000 0.000 Y ZNF2 n/a
10 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1577 CDS 100% 13.200 6.600 Y Zfp977 n/a
11 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1588 CDS 100% 5.625 2.813 Y ZNF570 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.