Transcript: Human XM_017026838.1

PREDICTED: Homo sapiens NOVA alternative splicing regulator 2 (NOVA2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NOVA2 (4858)
Length:
5300
CDS:
652..1803

Additional Resources:

NCBI RefSeq record:
XM_017026838.1
NBCI Gene record:
NOVA2 (4858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433099 CTTAACACGCTGGCAAGTTAC pLKO_005 1171 CDS 100% 10.800 15.120 N NOVA2 n/a
2 TRCN0000438843 AGAGCGGGTATGCCTAGTACA pLKO_005 561 5UTR 100% 4.950 6.930 N NOVA2 n/a
3 TRCN0000074598 CTGGTAGTCATAGGCAGGATT pLKO.1 1951 3UTR 100% 4.950 3.465 N NOVA2 n/a
4 TRCN0000074601 GCACAGCTTTATTGCCGAGAA pLKO.1 609 5UTR 100% 4.050 2.835 N NOVA2 n/a
5 TRCN0000445051 GGTGAAAGCCGTGATGGAACA pLKO_005 780 CDS 100% 4.050 2.835 N NOVA2 n/a
6 TRCN0000074602 CCGAGAAATCCCACAAGCGAT pLKO.1 633 5UTR 100% 2.640 1.848 N NOVA2 n/a
7 TRCN0000074600 CGCTCAATACCTCATCAGTCA pLKO.1 1728 CDS 100% 2.640 1.848 N NOVA2 n/a
8 TRCN0000074599 CCTCAACATCAGCTACGCCAA pLKO.1 951 CDS 100% 2.160 1.512 N NOVA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026838.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.