Transcript: Human XM_017027011.1

PREDICTED: Homo sapiens Meis homeobox 3 (MEIS3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEIS3 (56917)
Length:
2220
CDS:
382..1773

Additional Resources:

NCBI RefSeq record:
XM_017027011.1
NBCI Gene record:
MEIS3 (56917)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021306 GCCCTGGTCTTTGAGAAATGT pLKO.1 853 CDS 100% 5.625 3.938 N MEIS3 n/a
2 TRCN0000085827 CCACGACCTGTGCGACAACTT pLKO.1 1095 CDS 100% 1.650 1.155 N Meis3 n/a
3 TRCN0000311845 CCACGACCTGTGCGACAACTT pLKO_005 1095 CDS 100% 1.650 1.155 N Meis3 n/a
4 TRCN0000021304 GACCAGAATAATATGTGGATT pLKO.1 1237 CDS 100% 4.950 2.970 N MEIS3 n/a
5 TRCN0000021305 AGTTTGAACTTGGAAGGAGAA pLKO.1 1738 CDS 100% 4.050 2.430 N MEIS3 n/a
6 TRCN0000021307 CAATCTGATGATCCAGGCCAT pLKO.1 1035 CDS 100% 2.160 1.296 N MEIS3 n/a
7 TRCN0000021308 CCCTCGGAGGAGCAGAAGAAA pLKO.1 1513 CDS 100% 1.875 0.938 Y MEIS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027011.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.