Transcript: Human XM_017027073.1

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type S (PTPRS), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRS (5802)
Length:
6496
CDS:
132..5225

Additional Resources:

NCBI RefSeq record:
XM_017027073.1
NBCI Gene record:
PTPRS (5802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000320394 CCTATTACGTCATCGAATATA pLKO_005 460 CDS 100% 15.000 21.000 N PTPRS n/a
2 TRCN0000381949 ACGGATGACACGGCCGAATAT pLKO_005 1734 CDS 100% 13.200 18.480 N PTPRS n/a
3 TRCN0000002913 CGTCATCGAATATAAATCCAA pLKO.1 467 CDS 100% 3.000 4.200 N PTPRS n/a
4 TRCN0000380207 TGTGGAAATGAGACGCATTAA pLKO_005 3392 CDS 100% 13.200 9.240 N PTPRS n/a
5 TRCN0000002910 CCAGAGCTATTTCATTGTGAT pLKO.1 2831 CDS 100% 4.950 3.465 N PTPRS n/a
6 TRCN0000002914 TACTTGGCACATTCCTCCTTT pLKO.1 5445 3UTR 100% 4.950 3.465 N PTPRS n/a
7 TRCN0000320393 TACTTGGCACATTCCTCCTTT pLKO_005 5445 3UTR 100% 4.950 3.465 N PTPRS n/a
8 TRCN0000002911 CGTGGTCTTCATAATCTGCAT pLKO.1 3254 CDS 100% 2.640 1.848 N PTPRS n/a
9 TRCN0000320463 CGTGGTCTTCATAATCTGCAT pLKO_005 3254 CDS 100% 2.640 1.848 N PTPRS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027073.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.