Transcript: Human XM_017027105.2

PREDICTED: Homo sapiens UPF1 RNA helicase and ATPase (UPF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UPF1 (5976)
Length:
5932
CDS:
806..4219

Additional Resources:

NCBI RefSeq record:
XM_017027105.2
NBCI Gene record:
UPF1 (5976)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027105.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412485 AGATATGCCTGCGGTACAAAG pLKO_005 1920 CDS 100% 10.800 15.120 N UPF1 n/a
2 TRCN0000415625 AGATGCAGTTCCGCTCCATTT pLKO_005 2742 CDS 100% 10.800 15.120 N UPF1 n/a
3 TRCN0000022257 CCAACCCGATAAACCGATGTT pLKO.1 3082 CDS 100% 4.950 6.930 N UPF1 n/a
4 TRCN0000431324 TTACCTTGGTGACGAGTTTAA pLKO_005 4105 CDS 100% 13.200 10.560 N UPF1 n/a
5 TRCN0000009667 CCTGCGTGGTTTACTGTAATA pLKO.1 1200 CDS 100% 13.200 9.240 N Upf1 n/a
6 TRCN0000274538 CCTGCGTGGTTTACTGTAATA pLKO_005 1200 CDS 100% 13.200 9.240 N Upf1 n/a
7 TRCN0000413098 GTTCGAGTTCACCGACTTTAC pLKO_005 901 CDS 100% 10.800 7.560 N UPF1 n/a
8 TRCN0000022258 GCAAGGTATGGCGTCATCATT pLKO.1 3458 CDS 100% 5.625 3.938 N UPF1 n/a
9 TRCN0000022255 GCCTACCAGTACCAGAACATA pLKO.1 1700 CDS 100% 5.625 3.938 N UPF1 n/a
10 TRCN0000022256 GCTGAGTTGAACTTCGAGGAA pLKO.1 1106 CDS 100% 2.640 1.848 N UPF1 n/a
11 TRCN0000022254 GCATCTTATTCTGGGTAATAA pLKO.1 4263 3UTR 100% 1.500 1.050 N UPF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027105.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.