Transcript: Human XM_017027116.1

PREDICTED: Homo sapiens scaffold attachment factor B (SAFB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SAFB (6294)
Length:
2502
CDS:
921..2315

Additional Resources:

NCBI RefSeq record:
XM_017027116.1
NBCI Gene record:
SAFB (6294)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431888 GGTGGTAATCCTGACGAAATT pLKO_005 277 5UTR 100% 13.200 18.480 N SAFB n/a
2 TRCN0000022103 CGAAGATGACTCGGATACAAA pLKO.1 716 5UTR 100% 5.625 7.875 N SAFB n/a
3 TRCN0000022100 CGGACTGTAGTAATGGATAAA pLKO.1 1245 CDS 100% 13.200 10.560 N SAFB n/a
4 TRCN0000434945 AGAGGACAAAGAAACTATAAA pLKO_005 621 5UTR 100% 15.000 10.500 N SAFB n/a
5 TRCN0000022101 CGCAGCAGTTGTGGTAGAAAT pLKO.1 762 5UTR 100% 13.200 9.240 N SAFB n/a
6 TRCN0000022099 GCGCTACCATTCTGACTTTAA pLKO.1 1763 CDS 100% 13.200 9.240 N SAFB n/a
7 TRCN0000022102 GCAGATTGTGTCGAAGACGAT pLKO.1 505 5UTR 100% 2.640 1.848 N SAFB n/a
8 TRCN0000241738 AGTCCTGGAGCTCGCTGTTAT pLKO_005 888 5UTR 100% 13.200 9.240 N Safb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027116.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.