Transcript: Human XM_017027132.1

PREDICTED: Homo sapiens hypoxia inducible factor 3 subunit alpha (HIF3A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIF3A (64344)
Length:
6106
CDS:
28..2295

Additional Resources:

NCBI RefSeq record:
XM_017027132.1
NBCI Gene record:
HIF3A (64344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355674 CGGGTCAACGTGATCACATTT pLKO_005 2687 3UTR 100% 13.200 18.480 N HIF3A n/a
2 TRCN0000004606 ATGGCTTACCTGTCGGAGAAT pLKO.1 475 CDS 100% 4.950 3.960 N HIF3A n/a
3 TRCN0000355673 TGGAGACAGATTTAGATATAG pLKO_005 1574 CDS 100% 13.200 9.240 N HIF3A n/a
4 TRCN0000004608 GAGTATCGTCTGTGTCCATTT pLKO.1 1155 CDS 100% 10.800 7.560 N HIF3A n/a
5 TRCN0000355671 TGGCTTACCTGTCGGAGAATG pLKO_005 476 CDS 100% 10.800 7.560 N HIF3A n/a
6 TRCN0000004605 GCAGTGGAGACAGATTTAGAT pLKO.1 1570 CDS 100% 5.625 3.938 N HIF3A n/a
7 TRCN0000010897 CGGTCAGCAAGAGCATCCACA pLKO.1 1013 CDS 100% 0.880 0.616 N HIF3A n/a
8 TRCN0000355705 ATACTTGGTTACCTCATTATC pLKO_005 2565 3UTR 100% 13.200 7.920 N HIF3A n/a
9 TRCN0000412360 TCAGTCAGCTGGAGCTCATTG pLKO_005 515 CDS 100% 10.800 6.480 N Hif3a n/a
10 TRCN0000084952 ACATGGCTTACCTGTCGGAAA pLKO.1 473 CDS 100% 4.050 5.670 N Hif3a n/a
11 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 3429 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4574 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3394 3UTR 100% 4.950 2.475 Y LOC387873 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4574 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027132.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.