Transcript: Human XM_017027138.1

PREDICTED: Homo sapiens hypoxia inducible factor 3 subunit alpha (HIF3A), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HIF3A (64344)
Length:
3007
CDS:
30..2021

Additional Resources:

NCBI RefSeq record:
XM_017027138.1
NBCI Gene record:
HIF3A (64344)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004607 GATTTAGATATAGCTCAGGAT pLKO.1 1452 CDS 100% 2.640 3.696 N HIF3A n/a
2 TRCN0000004606 ATGGCTTACCTGTCGGAGAAT pLKO.1 345 CDS 100% 4.950 3.960 N HIF3A n/a
3 TRCN0000355673 TGGAGACAGATTTAGATATAG pLKO_005 1444 CDS 100% 13.200 9.240 N HIF3A n/a
4 TRCN0000004608 GAGTATCGTCTGTGTCCATTT pLKO.1 1025 CDS 100% 10.800 7.560 N HIF3A n/a
5 TRCN0000355671 TGGCTTACCTGTCGGAGAATG pLKO_005 346 CDS 100% 10.800 7.560 N HIF3A n/a
6 TRCN0000004605 GCAGTGGAGACAGATTTAGAT pLKO.1 1440 CDS 100% 5.625 3.938 N HIF3A n/a
7 TRCN0000010897 CGGTCAGCAAGAGCATCCACA pLKO.1 883 CDS 100% 0.880 0.616 N HIF3A n/a
8 TRCN0000412360 TCAGTCAGCTGGAGCTCATTG pLKO_005 385 CDS 100% 10.800 6.480 N Hif3a n/a
9 TRCN0000084952 ACATGGCTTACCTGTCGGAAA pLKO.1 343 CDS 100% 4.050 5.670 N Hif3a n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2175 3UTR 100% 5.625 2.813 Y EID2B n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2175 3UTR 100% 5.625 2.813 Y KLHL30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.