Transcript: Human XM_017027324.2

PREDICTED: Homo sapiens inositol-trisphosphate 3-kinase C (ITPKC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITPKC (80271)
Length:
2562
CDS:
1..1269

Additional Resources:

NCBI RefSeq record:
XM_017027324.2
NBCI Gene record:
ITPKC (80271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000199615 GCCTCTTCTTTCGACGAGTCT pLKO.1 229 CDS 100% 2.640 3.696 N ITPKC n/a
2 TRCN0000037718 CTTTGTGGTCTCCTTCCGAAA pLKO.1 351 CDS 100% 4.050 3.240 N ITPKC n/a
3 TRCN0000285301 TCAGCCACCATCAGGTTAATT pLKO_005 1275 3UTR 100% 15.000 10.500 N ITPKC n/a
4 TRCN0000380412 CTCAGAGGGTCAGCATCATTG pLKO_005 1715 3UTR 100% 10.800 7.560 N ITPKC n/a
5 TRCN0000275162 CTTTCGTGCCTGCCTACTATG pLKO_005 569 CDS 100% 10.800 7.560 N ITPKC n/a
6 TRCN0000196803 GACACATGAATCACTTCTAAC pLKO.1 1623 3UTR 100% 10.800 7.560 N ITPKC n/a
7 TRCN0000380826 GTGCCTGTGGACACATGAATC pLKO_005 1614 3UTR 100% 10.800 7.560 N ITPKC n/a
8 TRCN0000275164 GGTCGGATTCTGAAACGTTTC pLKO_005 496 CDS 100% 6.000 4.200 N ITPKC n/a
9 TRCN0000037716 CCGGAAGGACATGTATGAGAA pLKO.1 735 CDS 100% 4.950 3.465 N ITPKC n/a
10 TRCN0000037714 GTTTCCAAATACAACAGGATA pLKO.1 58 CDS 100% 4.950 3.465 N ITPKC n/a
11 TRCN0000174053 GTTTCCAAATACAACAGGATA pLKO.1 58 CDS 100% 4.950 3.465 N ITPKC n/a
12 TRCN0000199041 CCCTCCATTATGGACTGCAAG pLKO.1 655 CDS 100% 4.050 2.835 N ITPKC n/a
13 TRCN0000037717 CTGGATGATAGACTTCGGCAA pLKO.1 1119 CDS 100% 2.160 1.512 N ITPKC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027324.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.