Transcript: Human XM_017027366.1

PREDICTED: Homo sapiens DOT1 like histone lysine methyltransferase (DOT1L), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DOT1L (84444)
Length:
9633
CDS:
843..5402

Additional Resources:

NCBI RefSeq record:
XM_017027366.1
NBCI Gene record:
DOT1L (84444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236343 CACGTTGAACAAGTGCATTTA pLKO_005 7567 3UTR 100% 13.200 18.480 N DOT1L n/a
2 TRCN0000236346 ATCACTATGGCGTCGAGAAAG pLKO_005 764 5UTR 100% 10.800 15.120 N DOT1L n/a
3 TRCN0000020210 CCGCAAGAAGAAGCTAAACAA pLKO.1 1367 CDS 100% 5.625 7.875 N DOT1L n/a
4 TRCN0000020212 GCAGTGCTCGAATTGAGAGAA pLKO.1 3772 CDS 100% 4.950 3.960 N DOT1L n/a
5 TRCN0000236342 CACATTGGAGAGAGGCGATTT pLKO_005 870 CDS 100% 10.800 7.560 N DOT1L n/a
6 TRCN0000236344 GCCCGCAAGAAGAAGCTAAAC pLKO_005 1365 CDS 100% 10.800 7.560 N DOT1L n/a
7 TRCN0000020213 CAGATCAGCATTGTGGAGCTA pLKO.1 2106 CDS 100% 2.640 1.848 N DOT1L n/a
8 TRCN0000020211 CCCGGATCTCAAGCTCGCTAT pLKO.1 366 5UTR 100% 1.350 0.945 N DOT1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027366.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.