Transcript: Human XM_017027374.2

PREDICTED: Homo sapiens fibrillin 3 (FBN3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBN3 (84467)
Length:
9247
CDS:
399..8732

Additional Resources:

NCBI RefSeq record:
XM_017027374.2
NBCI Gene record:
FBN3 (84467)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053278 CCGAAACTCAGGAAGAGTGAA pLKO.1 8831 3UTR 100% 4.950 6.930 N FBN3 n/a
2 TRCN0000413387 GTGTCTGCTTCCGGCACTATA pLKO_005 5254 CDS 100% 13.200 9.240 N FBN3 n/a
3 TRCN0000426987 ATAAACCAGATCGGGAGTTTC pLKO_005 5514 CDS 100% 10.800 7.560 N FBN3 n/a
4 TRCN0000415934 GCTACGAATGCAAGATCAATG pLKO_005 8320 CDS 100% 10.800 7.560 N FBN3 n/a
5 TRCN0000053282 CATTGACATCTGCCGACACTT pLKO.1 1526 CDS 100% 4.950 3.465 N FBN3 n/a
6 TRCN0000053281 CGTGAATGAGTGTGCAGAGAA pLKO.1 6554 CDS 100% 4.950 3.465 N FBN3 n/a
7 TRCN0000053279 GCTGCACAGATGACAATGAAT pLKO.1 7048 CDS 100% 5.625 3.375 N FBN3 n/a
8 TRCN0000053280 CCATGTACCTTCCTCTGCAAA pLKO.1 7545 CDS 100% 4.950 2.970 N FBN3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027374.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.