Transcript: Human XM_017027588.1

PREDICTED: Homo sapiens synaptonemal complex protein 2 (SYCP2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYCP2 (10388)
Length:
5938
CDS:
447..4904

Additional Resources:

NCBI RefSeq record:
XM_017027588.1
NBCI Gene record:
SYCP2 (10388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229944 AGTCAGGACTCTAGGATTAAA pLKO_005 4518 CDS 100% 15.000 21.000 N SYCP2 n/a
2 TRCN0000155370 CCGAAGCAAGTGTACCCTTTA pLKO.1 5002 3UTR 100% 10.800 15.120 N SYCP2 n/a
3 TRCN0000151649 CGAGATAATTGCCTTGACTTA pLKO.1 3747 CDS 100% 4.950 6.930 N SYCP2 n/a
4 TRCN0000218004 CAATTGAAGAATCGCTGATAT pLKO_005 2662 CDS 100% 13.200 10.560 N SYCP2 n/a
5 TRCN0000152105 CCTTTATAGGAACCCTCAAAT pLKO.1 5017 3UTR 100% 13.200 10.560 N SYCP2 n/a
6 TRCN0000150677 GCTATTCAGATGTAAGCAGTT pLKO.1 4114 CDS 100% 4.050 3.240 N SYCP2 n/a
7 TRCN0000229943 ATGACAGCAAGACTGATATTA pLKO_005 3301 CDS 100% 15.000 10.500 N SYCP2 n/a
8 TRCN0000229945 GCTACTACATTGCCTAAATAT pLKO_005 5456 3UTR 100% 15.000 10.500 N SYCP2 n/a
9 TRCN0000218769 TGGACTTCTAACGATGATAAA pLKO_005 725 CDS 100% 13.200 9.240 N SYCP2 n/a
10 TRCN0000151648 CGGTTCTCCTAAATAAGACAA pLKO.1 2644 CDS 100% 4.950 3.465 N SYCP2 n/a
11 TRCN0000154469 GCCCAGAAGACTTCTGTCTAT pLKO.1 5092 3UTR 100% 4.950 3.465 N SYCP2 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 26 5UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 26 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027588.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.