Transcript: Human XM_017027647.2

PREDICTED: Homo sapiens SLX4 interacting protein (SLX4IP), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLX4IP (128710)
Length:
9669
CDS:
3675..4910

Additional Resources:

NCBI RefSeq record:
XM_017027647.2
NBCI Gene record:
SLX4IP (128710)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000139949 GATCGATTAGTCCCGAGAGAA pLKO.1 4629 CDS 100% 4.950 6.930 N SLX4IP n/a
2 TRCN0000121539 CTTTCAAATCACAGCCTATTT pLKO.1 3929 CDS 100% 13.200 9.240 N SLX4IP n/a
3 TRCN0000144510 CCACAAGGTTCAAACAAAGAT pLKO.1 3750 CDS 100% 5.625 3.938 N SLX4IP n/a
4 TRCN0000139139 CCATGGGACAAGCAAAGGATT pLKO.1 4336 CDS 100% 4.950 3.465 N SLX4IP n/a
5 TRCN0000139396 CAGCTTGCATTCAGTCGTGAT pLKO.1 4041 CDS 100% 4.050 2.835 N SLX4IP n/a
6 TRCN0000140391 GAGTTGTCAGATCCAGGGTTA pLKO.1 4695 CDS 100% 4.050 2.835 N SLX4IP n/a
7 TRCN0000283230 TCCATGGAGTGTCTGATTATT pLKO_005 4102 CDS 100% 15.000 10.500 N Slx4ip n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 7821 3UTR 100% 5.625 2.813 Y KLHL30 n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 7821 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027647.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.