Transcript: Human XM_017027728.2

PREDICTED: Homo sapiens BTB domain containing 3 (BTBD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BTBD3 (22903)
Length:
4767
CDS:
453..1838

Additional Resources:

NCBI RefSeq record:
XM_017027728.2
NBCI Gene record:
BTBD3 (22903)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148956 GCAGTCTTTGTCGTTGTTCAT pLKO.1 4396 3UTR 100% 4.950 6.930 N BTBD3 n/a
2 TRCN0000323018 GCAGTCTTTGTCGTTGTTCAT pLKO_005 4396 3UTR 100% 4.950 6.930 N BTBD3 n/a
3 TRCN0000149272 GCCATCTTAAAGTGCCAACAT pLKO.1 2988 3UTR 100% 4.950 6.930 N BTBD3 n/a
4 TRCN0000323020 AGAAGATGGCTGCTGATATAT pLKO_005 448 5UTR 100% 15.000 10.500 N BTBD3 n/a
5 TRCN0000323019 CACAATGGCCCTCGATGATTT pLKO_005 1238 CDS 100% 13.200 9.240 N BTBD3 n/a
6 TRCN0000148616 CCTTTCCCGTATGGTTTGAAT pLKO.1 1618 CDS 100% 5.625 3.938 N BTBD3 n/a
7 TRCN0000323089 CCTTTCCCGTATGGTTTGAAT pLKO_005 1618 CDS 100% 5.625 3.938 N BTBD3 n/a
8 TRCN0000148380 CTCAGCTACTTTGGACAAGAA pLKO.1 1701 CDS 100% 4.950 3.465 N BTBD3 n/a
9 TRCN0000149201 GAAAGTATTCTCCGTAGGGAA pLKO.1 1077 CDS 100% 2.640 1.848 N BTBD3 n/a
10 TRCN0000323088 GAAAGTATTCTCCGTAGGGAA pLKO_005 1077 CDS 100% 2.640 1.848 N BTBD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027728.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.