Transcript: Human XM_017027751.1

PREDICTED: Homo sapiens nuclear receptor coactivator 6 (NCOA6), transcript variant X19, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NCOA6 (23054)
Length:
4030
CDS:
270..3482

Additional Resources:

NCBI RefSeq record:
XM_017027751.1
NBCI Gene record:
NCOA6 (23054)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303656 GGAGCTAATGCCATTATAAAT pLKO_005 3718 3UTR 100% 15.000 21.000 N NCOA6 n/a
2 TRCN0000176319 CCTATGGTTCAACAGGGAAAT pLKO.1 1701 CDS 100% 10.800 15.120 N Ncoa6 n/a
3 TRCN0000063265 CGGGTGGAAATGTGTCATCTT pLKO.1 826 CDS 100% 4.950 3.960 N NCOA6 n/a
4 TRCN0000303657 ACAAATGAACCCAGCTAATTT pLKO_005 1019 CDS 100% 15.000 10.500 N NCOA6 n/a
5 TRCN0000063263 GCAGATTATGACCAATCAAAT pLKO.1 2411 CDS 100% 13.200 9.240 N NCOA6 n/a
6 TRCN0000299538 GCAGATTATGACCAATCAAAT pLKO_005 2411 CDS 100% 13.200 9.240 N NCOA6 n/a
7 TRCN0000303658 GCCCATTGTTGGTCAACTTAT pLKO_005 2920 CDS 100% 13.200 9.240 N NCOA6 n/a
8 TRCN0000063266 CGTCGCAGAATTTAGTCTCAA pLKO.1 3187 CDS 100% 4.950 3.465 N NCOA6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027751.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.