Transcript: Human XM_017027845.1

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily Q member 2 (KCNQ2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNQ2 (3785)
Length:
8673
CDS:
605..2239

Additional Resources:

NCBI RefSeq record:
XM_017027845.1
NBCI Gene record:
KCNQ2 (3785)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416391 GGACATGCTGTCCCGAATTAA pLKO_005 1240 CDS 100% 15.000 21.000 N KCNQ2 n/a
2 TRCN0000104865 CCAGGGAATGAACTCTAGTTT pLKO.1 8440 3UTR 100% 5.625 3.938 N Kcnq2 n/a
3 TRCN0000044041 CATGGAGAAGAAGCTGGACTT pLKO.1 1516 CDS 100% 4.050 2.430 N KCNQ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027845.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.