Transcript: Human XM_017027979.1

PREDICTED: Homo sapiens NDRG family member 3 (NDRG3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NDRG3 (57446)
Length:
3263
CDS:
383..1510

Additional Resources:

NCBI RefSeq record:
XM_017027979.1
NBCI Gene record:
NDRG3 (57446)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245521 TTCCCGCCTGAACCCTATAAA pLKO_005 1204 CDS 100% 15.000 21.000 N NDRG3 n/a
2 TRCN0000245524 ATGTTGACCCTTGCGCTAAAG pLKO_005 867 CDS 100% 10.800 15.120 N NDRG3 n/a
3 TRCN0000147764 GCCTGAACCCTATAAATACAA pLKO.1 1209 CDS 100% 5.625 7.875 N NDRG3 n/a
4 TRCN0000245523 ACATTGGCCTCAACCATAAAT pLKO_005 567 CDS 100% 15.000 10.500 N NDRG3 n/a
5 TRCN0000245522 CCACTCCATAATATAACATTT pLKO_005 1557 3UTR 100% 13.200 9.240 N NDRG3 n/a
6 TRCN0000245520 GTGTGGTCCACGTCACTATAA pLKO_005 501 CDS 100% 13.200 9.240 N NDRG3 n/a
7 TRCN0000183105 CCTCAACCATAAATCCTGTTT pLKO.1 574 CDS 100% 4.950 3.465 N NDRG3 n/a
8 TRCN0000147188 CAAAGGAAACAGACCAGTTAT pLKO.1 532 CDS 100% 13.200 7.920 N NDRG3 n/a
9 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 2784 3UTR 100% 4.950 2.475 Y LOC400464 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2857 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2857 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027979.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.