Transcript: Human XM_017028090.1

PREDICTED: Homo sapiens itchy E3 ubiquitin protein ligase (ITCH), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ITCH (83737)
Length:
6477
CDS:
176..2878

Additional Resources:

NCBI RefSeq record:
XM_017028090.1
NBCI Gene record:
ITCH (83737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355814 ACATGCCATCTACCGTCATTA pLKO_005 2551 CDS 100% 13.200 18.480 N ITCH n/a
2 TRCN0000355781 TCAACCACAACACACGAATTA pLKO_005 1536 CDS 100% 13.200 18.480 N ITCH n/a
3 TRCN0000002088 GCCTATGTTCGGGACTTCAAA pLKO.1 1733 CDS 100% 5.625 7.875 N ITCH n/a
4 TRCN0000010680 CGAAGACGTTTGTGGGTGATT pLKO.1 1886 CDS 100% 4.950 6.930 N ITCH n/a
5 TRCN0000002087 CCAGAAGTCAAGGTCAATTAA pLKO.1 1572 CDS 100% 15.000 10.500 N ITCH n/a
6 TRCN0000002090 CCCAAGAATCAGAGGTTATAT pLKO.1 5318 3UTR 100% 15.000 10.500 N ITCH n/a
7 TRCN0000355778 GACAACATGGGACGTATTTAT pLKO_005 1271 CDS 100% 15.000 10.500 N ITCH n/a
8 TRCN0000026903 CCAGGAGAAGAAGGTTTAGAT pLKO.1 1910 CDS 100% 5.625 3.938 N Itch n/a
9 TRCN0000002089 GCCGACAAATACAAATACAAA pLKO.1 1033 CDS 100% 5.625 3.938 N ITCH n/a
10 TRCN0000026905 GCAGCAGTTTAACCAGAGATT pLKO.1 1399 CDS 100% 4.950 3.465 N Itch n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028090.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.