Transcript: Human XM_017028104.1

PREDICTED: Homo sapiens chromodomain helicase DNA binding protein 6 (CHD6), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CHD6 (84181)
Length:
8966
CDS:
1672..8808

Additional Resources:

NCBI RefSeq record:
XM_017028104.1
NBCI Gene record:
CHD6 (84181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232792 CAAACTTCTGGAGGGTCTAAA pLKO_005 3498 CDS 100% 13.200 18.480 N CHD6 n/a
2 TRCN0000358974 CACGTCGTCATCACAACATTT pLKO_005 3385 CDS 100% 13.200 18.480 N CHD6 n/a
3 TRCN0000358973 GATACACCTATGAGCGAATTG pLKO_005 4142 CDS 100% 10.800 15.120 N CHD6 n/a
4 TRCN0000107416 GCACAGAAGATCAAGCGATTT pLKO.1 2707 CDS 100% 10.800 15.120 N CHD6 n/a
5 TRCN0000107417 CCCAAACAAGAGACGATCATT pLKO.1 3751 CDS 100% 5.625 4.500 N CHD6 n/a
6 TRCN0000232795 ATTCCATCACAGCCGTTTAAA pLKO_005 7624 CDS 100% 15.000 10.500 N CHD6 n/a
7 TRCN0000232793 TTGCATGATGATGGCTATAAG pLKO_005 5311 CDS 100% 13.200 9.240 N CHD6 n/a
8 TRCN0000107418 CGCATTGAACTGTTACGGAAA pLKO.1 6295 CDS 100% 4.050 2.835 N CHD6 n/a
9 TRCN0000107419 GCAAGAACTCTGTACCGCATT pLKO.1 6280 CDS 100% 4.050 2.835 N CHD6 n/a
10 TRCN0000232794 CCAGACCAACTCCAAGTTATA pLKO_005 6573 CDS 100% 13.200 7.920 N CHD6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.