Transcript: Human XM_017028157.1

PREDICTED: Homo sapiens transmembrane 9 superfamily member 4 (TM9SF4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TM9SF4 (9777)
Length:
3936
CDS:
520..2169

Additional Resources:

NCBI RefSeq record:
XM_017028157.1
NBCI Gene record:
TM9SF4 (9777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060008 CGGTGGTACATGAACCGATTT pLKO.1 1720 CDS 100% 10.800 15.120 N TM9SF4 n/a
2 TRCN0000311220 CGGTGGTACATGAACCGATTT pLKO_005 1720 CDS 100% 10.800 15.120 N Tm9sf4 n/a
3 TRCN0000303540 CTCGAACCCAGCTACCTTATG pLKO_005 433 5UTR 100% 10.800 15.120 N TM9SF4 n/a
4 TRCN0000303539 ATGGATCCAGGATGGATAAAT pLKO_005 2503 3UTR 100% 15.000 10.500 N TM9SF4 n/a
5 TRCN0000060011 GCATTCTACGTCCTGGTTTAT pLKO.1 1975 CDS 100% 13.200 9.240 N TM9SF4 n/a
6 TRCN0000060012 GCGGATCACAGAAGACTACTA pLKO.1 609 CDS 100% 4.950 3.465 N TM9SF4 n/a
7 TRCN0000299328 GCGGATCACAGAAGACTACTA pLKO_005 609 CDS 100% 4.950 3.465 N TM9SF4 n/a
8 TRCN0000060010 GCCTATCAACTTCCACCAGAA pLKO.1 374 5UTR 100% 4.050 2.835 N TM9SF4 n/a
9 TRCN0000126163 GCCAACTACAACAAGGAGGAT pLKO.1 1168 CDS 100% 2.640 1.848 N Tm9sf4 n/a
10 TRCN0000310739 TTTGGCATCTGCTTCGTATTG pLKO_005 1513 CDS 100% 10.800 6.480 N TM9SF4 n/a
11 TRCN0000060009 CCTCTCATTCATCCTTTACTA pLKO.1 786 CDS 100% 5.625 3.375 N TM9SF4 n/a
12 TRCN0000299250 CCTCTCATTCATCCTTTACTA pLKO_005 786 CDS 100% 5.625 3.375 N TM9SF4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.