Transcript: Human XM_017028376.2

PREDICTED: Homo sapiens solute carrier family 37 member 1 (SLC37A1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC37A1 (54020)
Length:
9184
CDS:
6479..8098

Additional Resources:

NCBI RefSeq record:
XM_017028376.2
NBCI Gene record:
SLC37A1 (54020)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043291 CGAAAGCCTATCAGCATAGTT pLKO.1 6686 CDS 100% 5.625 7.875 N SLC37A1 n/a
2 TRCN0000420950 ACATCCACAGTTTCGGATTCT pLKO_005 7023 CDS 100% 4.950 6.930 N SLC37A1 n/a
3 TRCN0000043290 CGTGGTAACTCAGGTCATCAA pLKO.1 7045 CDS 100% 4.950 6.930 N SLC37A1 n/a
4 TRCN0000439476 GCGCCTGCCGATTAGGTATTA pLKO_005 6937 CDS 100% 13.200 10.560 N SLC37A1 n/a
5 TRCN0000043288 CCGTTTGATAAGAACAACTAT pLKO.1 6836 CDS 100% 5.625 4.500 N SLC37A1 n/a
6 TRCN0000428405 TCCAGCCACAGAACATCAAAG pLKO_005 8469 3UTR 100% 10.800 7.560 N SLC37A1 n/a
7 TRCN0000439248 TTGACGTGGGCGGAATCTTTG pLKO_005 7686 CDS 100% 10.800 7.560 N SLC37A1 n/a
8 TRCN0000043289 GCTCTACATCTTCTCCACCAT pLKO.1 7792 CDS 100% 2.640 1.848 N SLC37A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028376.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.