Transcript: Human XM_017028670.2

PREDICTED: Homo sapiens GRAM domain containing 4 (GRAMD4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRAMD4 (23151)
Length:
4445
CDS:
173..1909

Additional Resources:

NCBI RefSeq record:
XM_017028670.2
NBCI Gene record:
GRAMD4 (23151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140554 GCCGGTCACTAACTTTGTGAA pLKO.1 811 CDS 100% 4.950 6.930 N GRAMD4 n/a
2 TRCN0000145154 GCCATCCCATTGTTCTTATTT pLKO.1 920 CDS 100% 15.000 10.500 N GRAMD4 n/a
3 TRCN0000442261 AGCACCAAGAAGGGCAATTTC pLKO_005 1493 CDS 100% 13.200 9.240 N GRAMD4 n/a
4 TRCN0000143929 CGATTTGGTAGTGGAAACAAT pLKO.1 1975 3UTR 100% 5.625 3.938 N GRAMD4 n/a
5 TRCN0000139186 CATTGCCTTCACCGTGTACAT pLKO.1 877 CDS 100% 4.950 3.465 N GRAMD4 n/a
6 TRCN0000144728 GAGATCTTCAATCTGACAGAA pLKO.1 1517 CDS 100% 4.950 3.465 N GRAMD4 n/a
7 TRCN0000139573 CAGAAGTACAAGGTCCTGTCT pLKO.1 1730 CDS 100% 2.640 1.848 N GRAMD4 n/a
8 TRCN0000142673 CCTGGAGAAGATCAAGAACTT pLKO.1 1129 CDS 100% 4.950 2.970 N GRAMD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.