Transcript: Human XM_017028920.1

PREDICTED: Homo sapiens solute carrier family 5 member 4 (SLC5A4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC5A4 (6527)
Length:
2403
CDS:
243..2312

Additional Resources:

NCBI RefSeq record:
XM_017028920.1
NBCI Gene record:
SLC5A4 (6527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432995 CTGATAGCTGGACGGATATTT pLKO_005 1599 CDS 100% 15.000 21.000 N SLC5A4 n/a
2 TRCN0000429259 ACAGAGGAGCGAATCGATATA pLKO_005 2031 CDS 100% 13.200 18.480 N SLC5A4 n/a
3 TRCN0000424815 TTAACGAAGTTGGAGGTTATG pLKO_005 1000 CDS 100% 10.800 15.120 N SLC5A4 n/a
4 TRCN0000042815 CCGTAACATTTGAATGGACTT pLKO.1 625 CDS 100% 4.050 5.670 N SLC5A4 n/a
5 TRCN0000079637 CCAGTAACTGTCCCAAGATTA pLKO.1 1873 CDS 100% 13.200 9.240 N Slc5a4b n/a
6 TRCN0000424752 GTGATGACCATGCCGGAATAT pLKO_005 705 CDS 100% 13.200 9.240 N SLC5A4 n/a
7 TRCN0000042814 CCACTGGTACAAGTTTCTCAA pLKO.1 1656 CDS 100% 4.950 3.465 N SLC5A4 n/a
8 TRCN0000042813 GCCAGGAATTATATTTGGAAT pLKO.1 1160 CDS 100% 4.950 3.465 N SLC5A4 n/a
9 TRCN0000174070 GCCAGGAATTATATTTGGAAT pLKO.1 1160 CDS 100% 4.950 3.465 N SLC5A4 n/a
10 TRCN0000042816 CCGCTTGCATTATGTGTGCTT pLKO.1 1267 CDS 100% 2.640 1.848 N SLC5A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028920.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.