Transcript: Human XM_017029026.1

PREDICTED: Homo sapiens MICAL like 1 (MICALL1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MICALL1 (85377)
Length:
3642
CDS:
521..2440

Additional Resources:

NCBI RefSeq record:
XM_017029026.1
NBCI Gene record:
MICALL1 (85377)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414130 AGGACAATGTCTTCGAGAATA pLKO_005 414 5UTR 100% 13.200 9.240 N MICALL1 n/a
2 TRCN0000421368 GGAGCCTAGAGTGGAACAAAT pLKO_005 1522 CDS 100% 13.200 9.240 N MICALL1 n/a
3 TRCN0000062136 GCAGGCAGAACCAAAGAAGAA pLKO.1 775 CDS 100% 4.950 3.465 N MICALL1 n/a
4 TRCN0000062135 GCTATCATCAACTGCCTGGAT pLKO.1 2210 CDS 100% 2.640 1.848 N MICALL1 n/a
5 TRCN0000062133 CCAAAGAATCTCTTGTTTCTT pLKO.1 2612 3UTR 100% 0.563 0.394 N MICALL1 n/a
6 TRCN0000062134 CCTGGAGTCCAAACCCTATAA pLKO.1 904 CDS 100% 13.200 7.920 N MICALL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029026.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.