Transcript: Human XM_017029037.1

PREDICTED: Homo sapiens calcium voltage-gated channel subunit alpha1 I (CACNA1I), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNA1I (8911)
Length:
13239
CDS:
5126..9907

Additional Resources:

NCBI RefSeq record:
XM_017029037.1
NBCI Gene record:
CACNA1I (8911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044168 CGCAAGATGATCGACGTCTAT pLKO.1 6662 CDS 100% 4.950 6.930 N CACNA1I n/a
2 TRCN0000429795 GCCCTACTATGCCACCTATTG pLKO_005 7672 CDS 100% 10.800 7.560 N CACNA1I n/a
3 TRCN0000044170 CTGGAGGAGATCGAGATCAAT pLKO.1 7973 CDS 100% 5.625 3.938 N CACNA1I n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029037.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.