Transcript: Human XM_017029084.1

PREDICTED: Homo sapiens LDL receptor related protein 5 like (LRP5L), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRP5L (91355)
Length:
4266
CDS:
3127..3885

Additional Resources:

NCBI RefSeq record:
XM_017029084.1
NBCI Gene record:
LRP5L (91355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244643 CAGTGTCGATGAGACGAAGAG pLKO_005 3570 CDS 100% 4.050 5.670 N LRP5L n/a
2 TRCN0000244644 TGCACACGTGCAGCCTATATG pLKO_005 4091 3UTR 100% 13.200 9.240 N LRP5L n/a
3 TRCN0000180533 GACGCTGATCAACACCAAGAT pLKO.1 3204 CDS 100% 4.950 3.465 N LRP5L n/a
4 TRCN0000180178 CGCTGATCAACACCAAGATCA pLKO.1 3206 CDS 100% 0.495 0.347 N LRP5L n/a
5 TRCN0000149335 GCTGATCAACACCAAGATCAA pLKO.1 3207 CDS 100% 0.495 0.347 N LRP5L n/a
6 TRCN0000244641 CCGATGACATCGCAGTCAACT pLKO_005 3233 CDS 100% 4.950 2.970 N LRP5L n/a
7 TRCN0000244642 GCAGACGCTGATCAACACCAA pLKO_005 3201 CDS 100% 2.640 1.584 N LRP5L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.