Transcript: Human XM_017029101.2

PREDICTED: Homo sapiens GTP binding protein 1 (GTPBP1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTPBP1 (9567)
Length:
2441
CDS:
122..2176

Additional Resources:

NCBI RefSeq record:
XM_017029101.2
NBCI Gene record:
GTPBP1 (9567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293695 TCCAAGCCGCAGCAGATTAAA pLKO_005 1745 CDS 100% 15.000 21.000 N GTPBP1 n/a
2 TRCN0000249960 GGATGCGGAGAGACCATATAT pLKO_005 163 CDS 100% 15.000 12.000 N Gtpbp1 n/a
3 TRCN0000293718 GGATGCGGAGAGACCATATAT pLKO_005 163 CDS 100% 15.000 12.000 N GTPBP1 n/a
4 TRCN0000047444 GCACTCAATGTACCTGTCTTT pLKO.1 887 CDS 100% 4.950 3.960 N GTPBP1 n/a
5 TRCN0000286315 GCACTCAATGTACCTGTCTTT pLKO_005 887 CDS 100% 4.950 3.960 N GTPBP1 n/a
6 TRCN0000047447 GCAGAGCAAAGATGATGTGAT pLKO.1 1018 CDS 100% 4.950 3.465 N GTPBP1 n/a
7 TRCN0000047445 CTTGGGTAACTTCCTGTCCAT pLKO.1 1294 CDS 100% 2.640 1.848 N GTPBP1 n/a
8 TRCN0000047446 GCGGAACAGATAGAGGCCGAT pLKO.1 341 CDS 100% 0.720 0.504 N GTPBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029101.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.