Transcript: Human XM_017029189.2

PREDICTED: Homo sapiens mastermind like domain containing 1 (MAMLD1), transcript variant X11, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAMLD1 (10046)
Length:
4703
CDS:
360..2486

Additional Resources:

NCBI RefSeq record:
XM_017029189.2
NBCI Gene record:
MAMLD1 (10046)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154098 CGTTACAATTTGAGTGGTGTT pLKO.1 3682 3UTR 100% 4.050 5.670 N MAMLD1 n/a
2 TRCN0000158218 CCACCAGTAAGCAGATAGTGT pLKO.1 1081 CDS 100% 3.000 4.200 N MAMLD1 n/a
3 TRCN0000156896 GCCTGACCATTCTTCATTCCT pLKO.1 2102 CDS 100% 3.000 4.200 N MAMLD1 n/a
4 TRCN0000281743 CTAGGTGGCTGAGTCGCTTAT pLKO_005 3969 3UTR 100% 10.800 8.640 N MAMLD1 n/a
5 TRCN0000271553 GGTCCCTCCATTGACAATAAA pLKO_005 611 CDS 100% 15.000 10.500 N MAMLD1 n/a
6 TRCN0000271552 TGAACGGCAGAATGCATATAT pLKO_005 2484 CDS 100% 15.000 10.500 N MAMLD1 n/a
7 TRCN0000271551 GAACAGAGATCAGGTCTTATG pLKO_005 2452 CDS 100% 10.800 7.560 N MAMLD1 n/a
8 TRCN0000155642 CAGTCATTACTGCTGGAGAAT pLKO.1 663 CDS 100% 4.950 3.465 N MAMLD1 n/a
9 TRCN0000156164 CCCTATGAATGGCAACATCAT pLKO.1 686 CDS 100% 4.950 3.465 N MAMLD1 n/a
10 TRCN0000158055 CCTCATGTCCTCTACCATCAA pLKO.1 1574 CDS 100% 4.950 3.465 N MAMLD1 n/a
11 TRCN0000155479 GCAAGGAGTTTGCTTCTAGTT pLKO.1 991 CDS 100% 4.950 3.465 N MAMLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029189.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.